Description
The FN50 monoclonal antibody specifically binds to human CD69. CD69 is also known as activation-induced molecule (AIM), early activation antigen (EA-1), very early activation antigen (VEA), C-type lectin domain family 2 member C (CLEC2C), MLR-3, GP32/28 and Leu-23. CD69 is a transmembrane type II homodimer receptor. CD69 is comprised of disulfide-linked, differentially glycosylated core protein subunits that are approximately 28 and 34 kDa in size. Each subunit contains a C-type lectin domain. CD69 is expressed on activated T, B, and natural killer (NK) lymphocytes, thymocytes, neutrophils, eosinophils and platelets. In normal peripheral blood, a small and variable percentage of lymphocytes typically express detectable membrane CD69 antigen. Upon activation, CD69 antigen expression increases on lymphocytes. Peak CD69 expression generally occurs within 18 hours of activation, preceding the appearance of HLA-DR, IL-2Rα (CD25) and transferrin receptor (CD71). CD69 is highly expressed on the bright CD3+ subset of thymocytes. FN50 monoclonal antibody labels NK cells and most lymphocytes of the follicular mantle and perifollicular/interfollicular zone as well as germinal center T cells of lymph nodes and tonsils. Studies indicate that CD69 serves as a signaling receptor in the activation of a variety of cell types.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameAIM; CLEC2C; EA1; GP32/28; Leu23; MLR-3; VEA; BL-AC/P26
Entrez Gene ID969
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCAATAACGGGTCATAGTAAGTCGCGAGTAAGAGGGC
Sequence IDAHS0010
ImmunogenAnti-µ stimulated human B lymphocytes
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse