Description
The RPA-2.10 monoclonal antibody specifically binds to CD2 which is also known as Lymphocyte-function antigen-2 (LFA-2), LFA-3 receptor, Erythrocyte receptor, Sheep red blood cell (SRBC) receptor, or T-cell surface antigen T11/Leu-5. CD2 is a 50 kDa type I transmembrane glycoprotein. CD2 belongs to the immunoglobulin superfamily of proteins along with its primary ligand, LFA-3 (CD58). It is expressed on the surface of ~80-90% of human peripheral blood lymphocytes, greater than 95% of thymocytes, all T lymphocytes that form E-rosettes, and a subset of NK cells. CD2 functions as an adhesion receptor that binds to CD58 resulting in the activation of CD2-positive T cells and NK cells and in the regulation of their cytolytic activities.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLFA-2; LFA-3 receptor; SRBC; T-cell surface antigen T11/Leu-5; erythrocyte receptor
Entrez Gene ID914
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAAACGTAGATTAGAGCCGGGTATGTCGCAACTGATT
Sequence IDAHS0029
ImmunogenHuman Phytohemagglutinin-treated Lymphoblasts
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940046 Oligo Mouse Anti-Human CD2 RPA-2.10 | IRIGHT