Description
The 1G1 monoclonal antibody specifically binds to CD194, also known as the human CC Chemokine Receptor type 4 (CCR4). CCR4 is expressed on activated Th2 cells, regulatory T cells, activated NK cells, basophils, monocytes and platelets. CCR4 is a seven-transmembrane, G-protein-coupled receptor, and is the specific receptor for CC chemokines, CCL22/MDC/Macrophage-Derived Chemokine and CCL17/TARC/Thymus and Activation-Regulated Chemokine. It has been reported that CCR4 mRNA is expressed mainly in the thymus and spleen. The human CCR4 gene has been mapped to chromosome 3p24. The purified form of this antibody has been reported not to be a neutralizing antibody. The immunogen used to generate the 1G1 hybridoma has been reported to be human CCR4 transfected L1.2 mouse lymphoma cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCCR4; C-C chemokine receptor type 4; CMKBR4; K5-5
Entrez Gene ID1233
Vol. Per Test2 µl
IsotypeMouse C57BL/6 IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAATATTAGTGGGTCCTCGCGTTGGCCGGTTGTTAGT
Sequence IDAHS0038
ImmunogenHuman CCR4 Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse