Description
The JS-81 monoclonal antibody specifically binds to CD81, which is also known as, Target of the antiproliferative antibody 1 (TAPA1, TAPA-1), or Tetraspanin-28 (Tspan-28/TSPAN28). CD81 is an ~26 kDa transmembrane protein that belongs to the tetraspanin (TM4SF) family. It is involved in cell growth and signal transduction. CD81 has a very broad cellular distribution, being expressed on cells of hematopoietic, neuroectodermal and mesenchymal origin. In hematopoietic cells, the CD81 antigen is expressed on B and T lymphocytes, NK cells, thymocytes, eosinophils, germinal center follicular dendritic cells, and to a variable extent on monocytes. The CD81 antigen is not expressed on neutrophils, platelets, or erythrocytes. CD81-specific antibodies have been shown to have anti-proliferative effects on different lymphoid cell lines, particularly those derived from large cell lymphomas. They are also reported to induce homotypic cell aggregation. Immunoprecipitation studies reveal that CD81 is a component of a multimolecular complex of CD19, CD21, and CD225 that is involved in the activation and control of B cell growth.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameTAPA1; Tetraspanin-28; Tspan-28; TSPAN28; CVID6; S5.7; M38
Entrez Gene ID975
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTTAGATTGACGGTCGAAGAGTTACGCCTGATTGTGT
Sequence IDAHS0021
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940052 Oligo Mouse Anti-Human CD81 (TAPA-1) JS-81 (also known | IRIGHT