Description
The TRAP1 monoclonal antibody specifically binds to CD154. CD154 is a 39 kDa type II membrane glycoprotein that is a member of the tumor necrosis factor superfamily, Tumor necrosis factor ligand superfamily member 5 (TNFSF5). CD154 is expressed on a variety of cell types including activated CD4+ T cells and some CD8+ T cells, NK cells, mast cells and basophils. CD154 is also known as CD40 ligand (CD40L); it serves as a ligand for CD40 that is expressed on B cells, macrophages, and dendritic cells. The expression of CD154 by activated T-helper cells costimulates B-cell activation and proliferation through binding to CD40 expressed on B cells. In response to T-dependent antigens, the CD154 and CD40 interaction is required for B-lymphocyte differentiation, including immunoglobulin production and isotype switching and memory B cell generation. The TRAP1 antibody can partially block T cell-B cell interaction and inhibit the subsequent proliferation, differentiation, and memory formation of B cells. It has been reported that patients with X-linked hyper-IgM syndrome have defective expression of functional CD154 due to mutations in the CD40LG gene that encodes CD154.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD40LG; CD40 ligand; CD40L; TNFSF5; T-BAM; TRAP
Entrez Gene ID959
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTAAGAGGTAAGTGCATTCGGGTATAGGCGTGATTTG
Sequence IDAHS0077
ImmunogenHuman TRAP1 Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse