Description
The 9E2/Nkp46 monoclonal antibody specifically binds to CD335. CD335 is also known as the Natural killer cell p46-related protein (NKp46) and the Natural cytotoxicity triggering receptor 1 (NCR1). CD335 is a 46 kDa type I membrane glycoprotein that is expressed on resting and activated NK cells. Its extracellular region contains two C2-type, Ig-like domains. The transmembrane domain contains a positively charged amino acid (Arg) which could be involved in stabilizing the association with CD3ζ. Its intracellular region does not contain immunoreceptor tyrosine-based activating motifs (ITAM), but it is linked to intracytoplasmic transduction machinery by its association with CD3ζ and FcεRIγ adaptor proteins. CD335 along with NKp30 and NKp44 are referred to as natural cytotoxicity receptors (NCR). These receptors play very important roles in cells that kill virus-infected target cells, tumor cells and MHC-class I-unprotected cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameNCR1; NK-p46; hNKp46; LY94; Natural cytotoxicity triggering receptor 1
Entrez Gene ID9437
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCAATTTGTTCGCGTTTAGTAGTCGTCGTCTTATGGG
Sequence IDAHS0068
ImmunogenHuman NKp46 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse