Description
The 19.2 monoclonal antibody specifically binds to CD206 which is also known as the macrophage mannose receptor (MMR) or C-type lectin domain family 13 member D (CLEC13D). CD206 is a type I transmembrane glycoprotein of approximately 162 kDa which binds to glycoconjugates containing mannose, fucose, or N-acetylglucosamine. These carbohydrates are present on the surface of many microorganisms and enable the macrophage to bind to microorganisms through the MMR and internalize them during the process of phagocytosis. CD206 is expressed on human macrophages, endothelial cells, and cultured dendritic cells. It is not detected on resting monocytes. Mannose receptor expression is upregulated on peripheral blood mononuclear cells following 3 day incubation with GM-CSF.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameMacrophage mannose receptor; MMR; MRC1; CLEC13D
Entrez Gene ID4360
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGCTGGTTATCGTTTGAGAGTCGGTATGGAATGCGGT
Sequence IDAHS0072
ImmunogenHuman Placental Macrophage Mannose Receptor
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940068 Oligo Mouse Anti-Human CD206 19.2 | IRIGHT