Description
The HA58 monoclonal antibody specifically binds to CD54 which is also known as ICAM-1 (intracellular adhesion molecule-1). CD54 is an 85-110 kDa type I transmembrane glycoprotein that belongs to the immunoglobulin supergene family. A soluble form of CD54 can also be found in biological fluids. CD54 is expressed on endothelial cells and both resting (weak) and activated (moderate) lymphocytes and monocytes. CD54 is a ligand for LFA-1 (CD11a/CD18) and Mac-1 (CD11b/CD18). The CD54 adhesion molecule plays roles in inflammatory and immune responses and neoplasia. This antibody (NA/LE format) blocks the mixed-lymphocyte reaction (MLR) and the purified format is suitable for staining acetone-fixed, frozen tissue sections.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameICAM-1; intercellular adhesion molecule 1; BB2; P3.58
Entrez Gene ID3383
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAAGAGAATATATGCGTGCGTTGTTAAGGGAATGCGT
Sequence IDAHS0076
ImmunogenIFN-γ-treated BM314 colonic carcinoma cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse