Description
The 1A4 monoclonal antibody specifically binds to CD141. CD141 is a 75 kDa, single chain, type I membrane glycoprotein referred to as thrombomodulin and fetomodulin. CD141 is expressed on endothelial cells, smooth muscle cells, epithelial cells, synovial lining cells, and keratinocytes. It is also found on megakaryocytes, dendritic cells, peripheral blood monocytes, and neutrophils, but not on lymphocytes. Reports indicate that CD141 plays an important role in Protein C activation and the initiation of the Protein C anticoagulant pathway. Thrombin loses its procoagulant function when it binds to CD141, and the CD141/thrombin complex is able to activate Protein C.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameThrombomodulin; TM; THBD; THRM; AHUS6; Fetomodulin; BDCA-3
Entrez Gene ID7056
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGGAAGTAAGTATGGGTCGGCGTAAATTGTGCGTGT
Sequence IDAHS0083
ImmunogenPurified Human Thrombomodulin
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse