Description
The T47-530 specifically recognizes the Lymphocyte Activation Gene 3 (LAG-3) protein which is also known as, Protein FDC, or CD223. LAG-3 is a ~70 kDa type I transmembrane glycoprotein that belongs to the Ig superfamily and exhibits homology to CD4. LAG-3 is expressed on NK cells, regulatory T cells, and activated conventional T cells with higher expression found on CD8+ T cells compared with CD4+ T cells. LAG-3 is an activation induced cell surface molecule that like CD4, binds MHC class II molecules, but with much higher affinity. This may enable LAG-3 to act as a negative competitor of CD4 for MHC class II ligand binding. LAG-3 may associate with the TCR-CD3 complex to downregulate TCR signal transduction and T cell clonal expansion. In contrast, LAG-3-induced signaling may promote dendritic cell activation.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLAG3; CD223; FDC; Lymphocyte activation gene 3 protein; Protein FDC
Entrez Gene ID3902
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCGGCATGAATTAGGCGAGACTTAGTATACGAGCTGG
Sequence IDAHS0018
ImmunogenHuman LAG-3 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse