Description
The p44-8 monoclonal antibody specifically binds to the natural killer (NK) cell receptor, NKp44, which is also known as CD336, Natural cytotoxicity triggering receptor 2 (NCR2), or Lymphocyte antigen 95 homolog (Ly95). NKp44 is a ~44 kDa type I transmembrane protein that belongs to the natural cytotoxicity receptor (NCR) family within the immunoglobulin superfamily. NKp44 is expressed by activated NK cells. NKp44 serves as an activating receptor that can enhance NK cell mediated lysis of target cells including tumor cells and virus-infected cells. Killer activating receptor associated protein (KARAP), which is also known as DAP12, is an intracellular adaptor protein that can associate with the intracellular region of NKp44. DAP12 can then function to help transmit activating signals through its immunoreceptor tyrosine-based activation motif (ITAM).
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD336; NCR2; NCTR2; NKp44; NK-p44; LY95; dJ149M18.1
Entrez Gene ID9436
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAATGCAAACGATATCACGAAGGGTAGTACACGACGG
Sequence IDAHS0090
ImmunogenHuman NKp44
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940085 Oligo Mouse Anti-Human NKp44 (CD336) p44-8 | IRIGHT