Description
The M5 monoclonal antibody specifically binds to human CD126 which is also known as the alpha subunit of the human IL-6 Receptor (IL-6Rα). CD126 is an 80 kDa type I transmembrane glycoprotein, also known as gp80 and B cell stimulatory factor-2 (BSF-2) Receptor. The IL-6Rα subunit associates with the 130-160 kDa gp130 subunit (IL-6 Receptor β chain, CD130), that is shared with the receptor complexes for Leukemia Inhibitory Factor (LIF), Ciliary Neurotropic Factor (CNTF), Oncostatin M (OSM), IL-11, Cardiotropin 1 (CT-1) and possibly Neurotrophin-1/B Cell-Stimulating Factor 3 (NNT-1/BSF-3). The IL-6Rα chain binds IL-6 with low affinity; however the association with CD130 stabilizes the IL-6/IL-6Rα complex resulting in the formation of a high affinity ligand-receptor complex. The IL-6Rβ chain mediates signal transduction. CD126 is expressed at high levels by activated and EBV-transformed B cells, plasma cells and myeloma cells and at lower levels by most leucocytes, epithelial cells, fibroblasts, hepatocytes and neural cells. IL-6Rα exists in soluble form in human serum. The serum levels of soluble IL-6Rα appear to elevate in pathological situations such as multiple myeloma, Grave's disease, juvenile chronic arthritis and HIV. The M5 antibody is directed against an epitope not involved in interactions of CD126 with IL-6 or CD130.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameInterleukin 6 Receptor alpha chain; IL-6R alpha; IL-6Rα
Entrez Gene ID3570
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAATGGTGAATCGCCCTAGCAAGTGGTATCGGAATCG
Sequence IDAHS0096
ImmunogenCD126 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940090 Oligo Mouse Anti-Human CD126 M5 | IRIGHT