Description
The 17A12 monoclonal antibody specifically binds to the IL-21 Receptor (IL-21R). The IL-21R, also known as CD360, is a 538 amino acid cytokine receptor with an extracellular domain consisting of one copy of the conserved WSXWS -containing cytokine-binding domain. The IL-21 receptor combines with the common cytokine-receptor γ-chain to form a functional receptor complex for IL-21. IL-21 is mainly produced by activated CD4+ T cells including T follicular helper (Tfh) cells. IL-21R is preferentially expressed by B cells, T cells, NK cells, some populations of myeloid cells, keratinocytes, and dendritic cells. Binding of its ligand, IL-21, in these cells results in the activation of the Jak/Stat signal transduction pathway. The effects IL-21 ligand binding has pleiotropic actions such as augmenting the proliferation of T cells, driving of B cells into memory cells, terminally differentiating plasma cells and augmenting the activity of natural killer cells. IL-21 receptor has anti-tumor activity and might have a role in the development of autoimmunity; it has been reported that the IL-21 receptor affects the homeostasis of regulatory T cells and it could enhance T cell-activated responses in human immune-inflammatory diseases.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameInterleukin-21 receptor; CD360; NILR
Entrez Gene ID50615
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCGGTGGGTCTCGCGTACGTAATATAATAGGCTAATG
Sequence IDAHS0107
ImmunogenHuman IL-21R Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse