Description
The RA3-6B2 monoclonal antibody specifically binds to an epitope on the extracellular domain of the transmembrane CD45 glycoprotein which is dependent upon the expression of exon A and specific carbohydrate residues. It is expressed on B lymphocytes at all stages from pro-B through mature and activated B cell, but it is decreased on plasma cells and a subset of memory B cells. The levels of CD45R expression on the B-cell lineage appear to be developmentally regulated. It is also reportedly found on the abnormal T cells involved in the lymphadenopathy of lpr/lpr and gld/gld mutant mice, on lytically active subsets of lymphokine-activated killer cells (NK cells and non-MHC-restricted CTL), on apoptotic T lymphocytes of mice injected with bacterial superantigen, on a population of NK-cell precursors in the bone marrow, and on B-lymphocyte, T-lymphocyte, and macrophage progenitors in fetal liver. The CD45R antigen has been reported not to be on hematopoietic stem cells, naive T lymphocytes, or MHC-restricted CTL. CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family: Its intracellular (COOH-terminal) region contains two PTP catalytic domains, and the extracellular region is highly variable due to alternative splicing of exons 4, 5, and 6 (designated A, B, and C, respectively), plus differing levels of glycosylation. The CD45 isoforms detected in the mouse are cell type-, maturation, and activation state-specific. The CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction. CD45R is commonly used as a pan B-cell marker; however, CD19 expression, detectable by the rat anti-mouse CD19 antibody (clone 1D3), is reported to be more restricted to the B-cell lineage. The rat anti-mouse CD45R antibody (clone RA3-6B2) has been reported to enhance isotype switching during in vitro B-cell responses and to inhibit in vivo B-cell responses. Cross-reaction of the RA3-6B2 clone with activated human T lymphocytes has also been reportedly observed.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameB220; Ly-5; CD45R; LCA; Ptprc; Protein tyrosine phosphatase receptor type C
Entrez Gene ID5788, 19264
Vol. Per Test2 µl
IsotypeRat IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGTGGGTTAGGACGTTATGATCGAGTATTAGGGAGGC
Sequence IDAMM2006
ImmunogenMouse Abelson Leukemia Virus-Induced pre-B tumor cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940110 Oligo Rat Anti-Mouse CD45R/B220 RA3-6B2 | IRIGHT