Description
The MEC13.3 antibody specifically recognizes CD31, also known as PECAM-1 (Platelet Endothelial Cell Adhesion Molecule-1). CD31 is a 130 kDa integral membrane protein, a member of the immunoglobulin superfamily, that mediates cell-to-cell adhesion. CD31 is expressed constitutively on the surface of adult and embryonic endothelial cells and is also expressed on many peripheral leukocytes and platelets. It has also been detected on bone marrow-derived hematopoietic stem cells and embryonic stem cells. CD31 is involved in the transendothelial emigration of neutrophils, and neutrophil PECAM-1 appears to be down-regulated after extravasation into inflamed tissues. Multiple alternatively spliced isoforms are detected during early post-implantation embryonic development; this alternative splicing is involved in the regulation of ligand specificity. CD38 and vitronectin receptor (αvβ3 integrin, CD51/CD61) are proposed to be ligands for CD31. CD31-mediated endothelial cell-cell interactions are involved in angiogenesis. The MEC13.3 mAb inhibits a variety of in vitro and in vivo functions mediated by CD31.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameEndoCAM; GPIIA; PECA1; PECAM1; Platelet endothelial cell adhesion molecule
Entrez Gene ID18613
Vol. Per Test2 µl
IsotypeRat LEW, also known as Lewis IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTAAGAAAGCGGTTGAAGGGACGAGTATAGAAGGGCC
Sequence IDAMM2011
Immunogen129/Sv mouse-derived endothelioma cell line tEnd.1
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat