Description
The RB6-8C5 monoclonal antibody recognizes a common epitope on Ly-6G and Ly-6C, previously known as the myeloid differentiation antigen Gr-1. In the bone marrow, the level of antigen expression is directly correlated with granulocyte differentiation and maturation. The antigen is also expressed on the monocyte lineage in the bone marrow, but not on erythroid cells. In the periphery, RB6-8C5 antibody recognizes granulocytes (neutrophils and eosinophils) and monocytes. The RB6-8C5 antibody is a component of the "lineage cocktail" used in studies of hematopoietic cell lineages. The 1A8 antibody (Cat. No. 551461) specifically recognizes Ly-6G, but not Ly-6C. Based on comparison of the staining patterns given by 1A8 versus RB6-8C5 antibodies on total blood leucocytes, it is evident that the 1A8 antibody stains the RB6-8C5-bright population, corresponding to Ly-6G-expressing granulocytes; whereas, the RB6-8C5-dim population is 1A8-negative and corresponds to Ly-6C-expressing lymphocytes and monocytes. Please refer to the Technical Data Sheets for Cat. No. 551459 and 553128 for more detailed information.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLy6c, Lymphocyte antigen 6C2; Lymphocyte antigen 6G, Ly6g, Gr-1
Entrez Gene ID17067, 546644
Vol. Per Test2 µl
IsotypeRat IgG2b, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCATTGCGAGGAGTAAGGCGATATCTAGTTGTGCTGG
Sequence IDAMM2015
ImmunogenNot Reported
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat