Description
The 37.51 antibody reacts with CD28, which is expressed on most thymocytes, at low density on nearly all CD4+ and CD8+ peripheral T cells, and at even lower density on NK cells. The expression of CD28, in splenocytes and thymocytes, has been reported to increase after activation. CD28 transcripts are found in mast cells, and cell-surface expression of CD28 is induced upon maturation or activation of mast cells. It has been reported that CD28 is not expressed on some populations of intraepithelial T lymphocytes. CD28 is a costimulatory receptor; its ligands include CD80 (B7-1) and CD86 (B7-2). The 37.51 mAb augments proliferation and cytokine production by activated T and NK cells and can provide a costimulatory signal for CTL induction. There is considerable evidence that CD28 is a costimulatory receptor involved in many, but not all, T cell-dependent immune responses.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
9. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCd28; CD28 antigen; T-cell-specific surface glycoprotein CD28
Entrez Gene ID12487
Vol. Per Test2 µl
IsotypeSyrian Hamster IgG2, λ1
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCGTGGGTTGATTAGCGATTATTATTCCGTTGTTGTC
Sequence IDAMM2016
ImmunogenMouse EL-4 (T-cell lymphoma) Cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesSyrian Hamster
BD 940120 Oligo Hamster Anti-Mouse CD28 37.51 | IRIGHT