Description
The H1.2F3 monoclonal antibody specifically binds to CD69 (Very Early Activation antigen), an 85 kDa disulfide-linked homodimer of differentially glycosylated subunits. CD69 is a C-type lectin, most closely related to the NKR-P1 and Ly-49 NK cell-activation molecules. Its expression is rapidly induced upon activation of lymphocytes (T, B, NK, and NK-T cells), neutrophils, and macrophages. CD69 is expressed also on thymocytes that are undergoing positive selection; its role in that process is unclear. H1.2F3 mAb augments PMA-induced T-cell stimulation and IFN-γ-induced macrophage stimulation. IL-2-activated NK cells express CD69, and H1.2F3 mAb induces redirected lysis of FcR-bearing target cells by NK cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameVEA; Very Early Activation Antigen; AIM; Activation Induced Molecule
Entrez Gene ID12515
Vol. Per Test2 µl
IsotypeArmenian Hamster IgG1, λ3
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTTAGAATGATTAGCGGTATATGTCGTGATGCAGCGT
Sequence IDAMM2022
ImmunogenMouse Dendritic Epidermal T Cell Line Y245
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesArmenian Hamster