Description
The D7 monoclonal antibody recognizes Ly-6A.2 and Ly-6E.1, which are allelic members of the Ly-6 multigene family. Sca-1 (Ly6A/E), a phosphatidylinositol-anchored protein of about 18 kDa, is expressed on the multipotent hematopoietic stem cells (HSC) in the bone marrow of mice with both Ly-6 haplotypes. In mice expressing the Ly-6.2 haplotype (e.g., AKR, C57BL, C57BR, C57L, C58, DBA/2, PL, SJL, SWR, 129), Ly-6A/E is also expressed on distinct subpopulations of bone marrow and peripheral B lymphocytes as well as thymic and peripheral T lymphocytes. Strains with the Ly-6.1 haplotype (e.g., A, BALB/c, CBA, C3H/He, DBA/1, NZB) have few Ly-6A/E+ resting peripheral lymphocytes; activation of lymphocytes from mice of both Ly-6 haplotypes leads to strong expression of the Sca-1 antigen. Studies with the D7 antibody have demonstrated that Ly-6A/E may be involved in the regulation of B and T lymphocyte responses, and appears to be required for T-cell receptor-mediated T-cell activation. The purified E13-161.7 mAb (anti-Ly-6A/E) can block binding of FITC-conjugated D7 antibody to mouse splenocytes, but purified mAb D7 is unable to block binding of FITC-conjugated E13-161.7 antibody. Anti-Ly-6A/E (Sca-1) mAb may be used in combination with a Mouse Lineage Panel of antibodies to identify HSC.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLy-6A/E; Lymphocyte antigen 6A-2/6E-1; Ly-6A.2/Ly-6E.1; Sca-1; TAP
Entrez Gene ID110454
Vol. Per Test2 µl
IsotypeRat LEW, also known as Lewis IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGTGGATAGGAGTGTTAGATACGGACGAATTGATGTT
Sequence IDAMM2026
ImmunogenIL-2-dependent mouse T-cell line CTL-L
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat