Description
The M290 antibody specificaly binds to CD103, the α chain of αIELβ7 integrin. CD103 has a unique and fairly restricted tissue distribution. It is expressed on almost all intestinal intraepithelial lymphocytes (IEL), dendritic epidermal T cells (DEC), subpopulations of peripheral T cells, and distinct subsets of fetal, neonatal, and adult thymocytes. E-cadherin is the epithelial cell ligand for αIELβ7 integrin. The ordered expression of αIEL during thymocyte development (which occurs under the influence of the thymic epithelium), high level of αIEL expression on peripheral T cells in epithelial tissues (IEL and DEC), and expression of CD103 on a subset of CD8+ lymphocytes responding to allogeneic epithelial cells, suggest that αIELβ7 integrin may have a common role in the interactions of T lymphocytes with epithelia during T-cell maturation and effector functions. CD103 is thought to play a role in allograft rejection. The M290 antibody is reported to efficiently inhibit αIELβ7-mediated adhesion in in vitro assays.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameItgae; Integrin alpha-E; αE; alpha-E1; ITAE; Integrin αIEL chain; aM290
Entrez Gene ID16407
Vol. Per Test2 µl
IsotypeRat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCATTAGTTAGACGGTAGAGTTGCGAAGAGATAGGCG
Sequence IDAMM2032
ImmunogenMouse Intestinal Epithelial Cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat