Description
The 16-10A1 monoclonal antibody specifically recognizes CD80 (B7-1). This member of the Ig superfamily, like CD86 (B7-2), can bind to either CD28 or CD152 (CTLA-4) and provide either costimulatory or coinhibitory signals to T cells, respectively. CD80 is constitutively expressed on dendritic cells, monocytes, and peritoneal macrophages as well as by activated B cells and T cells. The 16-10A1 antibody blocks binding of CTLA-4 Ig to CD80 as well as T-cell activation by Con A-elicited peritoneal exudate cells or CD80-transfected cell lines. However, the 16-10A1 antibody alone is not able to block T-cell activation by antigen-presenting cells. The 16-10A1 antibody may reportedly block the binding of another CD80-specific antibody, clone 1G10. In addition, the 16-10A1 antibody may crossreact with an activation antigen expressed on IFN-γ-activated alveolar macrophages of the dog.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCd80; B7; B7-1; Cd28l; Ly-53; MIC17; TSA1
Entrez Gene ID12519
Vol. Per Test2 µl
IsotypeArmenian Hamster IgG2, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGAGAGGGTATATTAGGCGTGCGTAGGAGTTAGTTG
Sequence IDAMM2037
ImmunogenMouse CD80 (B7) Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesArmenian Hamster
BD 940141 Oligo Hamster Anti-Mouse CD80 (B7-1) 16-10A1 | IRIGHT