Description
The 53-7.3 monoclonal antibody specifically binds to a monomorphic epitope of CD5, a member of the scavenger receptor cysteine-rich protein superfamily and the major ligand of CD72, found on thymocytes, T lymphocytes, thymic NKT cells, and a subset of B lymphocytes, but not on NK cells or splenic NKT cells. The level of surface CD5 expression is developmentally regulated in the thymus, starting with low levels on CD4-CD8- thymocytes and increasing as they mature to CD4+CD8+ then CD4+CD8- or CD4-CD8+ thymocytes. Relatively high levels are maintained on peripheral T lymphocytes. The level of CD5 antigen detected on T helper cells has been reported to be somewhat higher than that on T cytotoxic/suppressor and B cells. Few, if any, intestinal intraepithelial lymphocytes bearing the γδ T-cell receptor express CD5. Phenotypic, anatomical, functional, developmental, and pathogenic characteristics of peripheral CD5+ B cells suggest that they may represent a distinct lineage, known as B-1 cells. The frequency of these CD5+ B cells has been reported to show strain-dependent variation. An additional population of CD5+ B lymphocytes resides in the thymus, where it matures from intrathymic B-cell progenitors. It has been proposed that CD5 is a costimulatory molecule which mediates interactions of cells in the immune system and negatively regulates signal transduction mediated by the T-cell receptor and B-cell receptor.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLymphocyte antigen 1; Cd5; Ly-12; Ly-A; Lyt-1
Entrez Gene ID12507
Vol. Per Test2 µl
IsotypeRat LOU, also known as Louvain, LOU/C, LOU/M IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTCGGAGTTGCGGTAATTAGTATATCTTTCGGAGGCC
Sequence IDAMM2043
ImmunogenMouse Thymus / Spleen
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat