Description
The APA5 antibody monoclonal antibody specifically binds to CD140a, the Platelet-Derived Growth Factor Receptor alpha chain (PDGFR-a, PDGFR-α). CD140a is a receptor tyrosine kinase that is widely expressed on cells of mesenchymal origin in the embryo and adult. CD140a is expressed on several other cell types during embryonic development, but not on hematopoietic cells. CD140a binds to PDGF A and B chains, in contrast to PDGFR-b (CD140b) that binds only to the PDGF B chain. Biologically active PDGF is a disulphide-linked dimer, forming the AA, AB, and BB isoforms. Ligand binding to the PDGF Receptor induces the formation of receptor dimers (aa, ab, or bb), autophosphorylation, and internalization. The APA5 antibody has been demonstrated to block binding of PDGF-AA to PDGFR-a-expressing cells in vitro and to block some PDGF-mediated developmental events in vivo.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NamePdgfra; Pdgfr2; PDGF-R alpha; Platelet derived growth factor receptor alpha
Entrez Gene ID18595
Vol. Per Test2 µl
IsotypeRat WF, also known as Wistar Furth IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTCATTAGCATTGGGTTCGATATTGTTAGCAGGCCTT
Sequence IDAMM2045
ImmunogenMouse PDGF Receptor α chain
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat