Description
The GoH3 monoclonal antibody specifically binds to CD49f which is also known as integrin α6 chain. CD49f is a ~150 kDa type I transmembrane glycoprotein that belongs to the integrin alpha chain family of extracellular matrix and cell adhesion receptors. The integrin α6 subunit associates with the integrin β1 chain (CD29) to form VLA-6 and with the integrin β4 chain (CD104) to form the integrin α6β4 complex, also known as the laminin and kalinin receptor. CD49f is expressed mainly on T cells, monocytes, platelets, epithelial cells, endothelial cells, perineural cells, and trophoblasts of placenta. GoH3 recognizes an extracellular epitope of integrin α6 on human, mouse and bovine cells. GoH3 has been reported to block the binding of integrin α6 to laminin P1 and E8 fragments.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameITGA6; IThe GoH3 monoclonal ntegrin alpha-6; Integrin α6 chain; VLA-6; ITA6
Entrez Gene ID3655
Vol. Per Test2 µl
IsotypeRat SD, also known as Sprague-Dawley (outbred) IgG2a, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTTGGTTTCTACTCGATGGGTTCTATATATGCGGACT
Sequence IDAHS0119
ImmunogenMouse mammary tumor cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat