Description
The Avas 12α1 monoclonal antibody specifically binds to fetal liver kinase 1 (Flk-1) which is also known as CD309. Flk-1 is a receptor protein tyrosine kinase which is closely related to CD117 (c-kit) and CD140a (PDGF Receptor α chain) of the immunoglobulin superfamily. Flk-1, also known as VEGF Receptor-2 (VEGF-R2 or VEGFR2), is a receptor for vascular endothelial growth factor (VEGF). It is expressed, at the mRNA and protein levels, on distinct sets of mesoderm during gastrulation and on endothelial cells in embryonic and adult tissues. In vivo and in vitro studies indicate that Flk-1 is required for the embryonic development of vascular endothelial and hematopoietic cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD309; Fetal liver kinase 1; Kdr; VEGF Receptor-2; VEGFR-2; AVAS12;
Vol. Per Test2 µl
IsotypeRat WI, also known as Wistar (outbred) IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTATGAGTTCGTTTGCGGAGTAGGATCTGATTAGGTG
Sequence IDAMM2086
ImmunogenMouse Flk-1 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940190 Oligo Rat Anti-Mouse FLK-1 Avas 12alpha1 | IRIGHT