Description
The 5D12 monoclonal antibody specifically recognizes CD366 which is also known as TIM-3 (T-cell immunoglobulin and mucin domain-containing 3) or T-cell membrane protein 3. TIM-3 is encoded by Havcr2 (hepatitis A virus cellular receptor 2). TIM-3 is a type I transmembrane glycoprotein that belongs to the human TIM family within the immunoglobulin superfamily, having one Ig-like V-type domain in its extracellular region. TIM-3 is expressed on activated monocytes, macrophages, dendritic cells, microglia, and mast cells. It is also expressed on type-1 CD4+ (Th1-like) T cells, CD8+ T cytotoxic cells, regulatory T cells (Treg), and natural killer (NK) cells. TIM-3 functions as an inhibitory receptor which helps cells maintain immunological homeostasis and self tolerance. Crosslinking of cell surface TIM-3 by Galectin-9 binding downregulates Th1-like and CD8+ T cell responses and can promote Treg or myeloid-derived suppressor cells. TIM-3 enables dendritic cells to bind phosphatidyl serine expressed by apoptotic cells and to phagocytize these cells to quell potential inflammation. TIM-3 also binds to the alarmin HMGB1 thereby preventing Toll-like receptor (TLR) by released tumor cell DNA.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
3. Please refer to bd.com/genomics-resources for technical protocols.
4. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
5. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
6. Illumina is a trademark of Illumina, Inc.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCd366; T-cell membrane protein; Tim3; TIMD-3; Timd3; HAVcr-2; Havcr2;
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGTCATAGTAAGTTAGCGTGGTGTAGCAGCGGAAGTC
Sequence IDAMM2103
ImmunogenMouse TIM-3 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse