Description
The MI15 monoclonal antibody specifically binds to CD138 (Syndecan-1), an 85-92 kDa single chain transmembrane protein, which is strongly expressed on multiple-myeloma-derived cell lines and malignant plasma cell populations. It is also expressed on pre-B cells, immature B cells, and plasma cells, but not on mature circulating B-lymphocytes. Syndecan-1 is a member of the transmembrane heparan sulfate proteoglycans family. It is also expressed on some non-hematopoietic cells, including embryonic mesenchymal cells, vascular smooth muscle cells, endothelial and neural cells. CD138 binds to many extracellular matrix proteins through its heparan sulfate side-chains, like fibronectin, collagen types I, III, and V, tenascin, thrombospondin, and antithrombin III. It is considered an extracellular matrix receptor that may serve as a co-receptor for fibroblast growth factor and related molecules. Monoclonal antibody MI15 blocks the binding of clone B-B4 but not clone DL-101 (other anti-syndecan-1 antibodies) by flow cytometric analysis.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameSyndecan; SDC; Syndecan 1; SDC1; SYND1
Entrez Gene ID6382
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTAAGCTGCCGGTATTGGAAACGTATCGATCTATTGG
Sequence IDAHS0121
ImmunogenHuman U266 and XG-1 Myeloma Cell Lines
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940213 Oligo Mouse Anti-Human CD138 MI15 | IRIGHT