Description
The 9-4D2-1E4 monoclonal antibody specifically binds to CD115 which is also known as Colony stimulating factor 1 receptor (CSF-1R) or Macrophage colony-stimulating factor 1 receptor (M-CSFR). This type I transmembrane glycoprotein is a receptor tyrosine kinase (RTK) that belongs to the Ig superfamily. It is expressed on a variety of cells including those committed to the mononuclear phagocyte lineage, such as, monocytes, macrophages, and osteoclasts. CSF-1 binds to and signals through CSF-1R homodimers which undergo tyrosine autophosphorylation and transduce downstream signaling pathways resulting in cytoskeletal reorganization and gene expression. CSF-1R activation stimulates the proliferation, differentiation, and survival of cells within the mononuclear phagocyte system. Acting through CD115, CSF-1 induces macrophage spreading and motility, and in combination with RANKL, CSF-1 drives the differentiation of mononuclear phagocytes to become osteoclasts. Interleukin-34 (IL-34) is another ligand for CD115 that can induce similar, as well as, some different biological responses by CD115-positive target cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCSF-1R; CSF1R; C-FMS; FMS; FIM2; M-CSF-R
Entrez Gene ID1436
Vol. Per Test2 µl
IsotypeRat IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCTGGTGGCGGCGAATTTGGTTACGACATATAGGGTT
Sequence IDAHS0136
ImmunogenHuman CD115 Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940225 Oligo Rat Anti-Human CD115 (CSF-1R) 9-4D2-1E4 (also known | IRIGHT