Description
The TUGh4 monoclonal antibody specifically binds to CD132. CD132 is a 65-70 kDa type 1 transmembrane glycoprotein that is encoded by the IL2RG (interleukin 2 receptor, gamma) gene. CD132 is also known as the common γ subunit (γc) and is shared by the IL-2, IL-4, IL-7, IL-9, IL-15 and IL-21 receptor complexes. CD132 is broadly expressed by most peripheral T and B lymphocytes, NK cells, monocytes, and granulocytes. The cytoplasmic domain of the γc chain plays an important role in cytokine-mediated signal transduction. Mutation of the IL2RG gene results in X-linked severe combined immunodeficiency (XSCID). The TUGh4 antibody recognizes a different epitope from that recognized by the CD132-specific clone, AG184.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameIL-2RG; IL-2Rγ; γc; Common γ chain; Common gamma chain; gamma c; SCIDX1
Entrez Gene ID3561
Vol. Per Test2 µl
IsotypeRat IgG2b, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceCAGGGACCGTGATTGCGATTGTGGCGTATTTATTTC
Sequence IDAHS0144
ImmunogenHuman γc Transfected Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940230 Oligo Rat Anti-Human CD132 TUGh4 | IRIGHT