Description
The L133.1 monoclonal antibody specifically recognizes CD31, the platelet/endothelial cell adhesion molecule-1 (PECAM-1), a 130 to 140-kilodalton (kDa) single-chain integral membrane glycoprotein that is a member of the immunoglobulin gene superfamily. The CD31 antigen is composed of six extracellular immunoglobulin-like domains belonging to the C2 group. C2 domains are also found in other members of the immunoglobulin superfamily, the cell adhesion molecules (CAMs). The CD31 antigen functions as a vascular cell adhesion molecule and is involved in the process of leucocyte migration through the intercellular junctions of vascular endothelial cells. It may also be involved in thrombosis, angiogenesis, wound healing, and inflammation. The CD31 antigen is expressed on endothelial cells, platelets, T-lymphocyte subsets, monocytes, and granulocytes. The CD31 antigen has also been found in metastatic colon carcinoma. The CD31 antigen is the only known member of the CAM family to be expressed on platelets. The antigen is localized at regions of cell-cell contacts and may function as an adhesion molecule, mediating adhesion between leucocytes/endothelial cells, leucocytes/platelets, and endothelial cells/endothelial cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameEndoCAM; GPIIA'; PECA1; PECAM1; Platelet endothelial cell adhesion molecule
Entrez Gene ID5175
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGGTGTGGTATAAGTCGGTGTCTAGGATTGGCTGTTT
Sequence IDAHS0150
ImmunogenPurified Human Natural Killer Cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse