Description
The 17G10.2 monoclonal antibody specifically binds to human Immunoglobulin Like Transcript 7 (ILT7), also known as CD85g. The ILT7 protein is encoded by the LILRA4 (Leukocyte Immunoglobulin Like Receptor subfamily A member 4) gene. ILT7 is a member of immunoglobulin-like transcripts (ILT) or leukocyte immunoglobulin-like receptor (LIR) gene family. ILT7 is selectively expressed on plasmacytoid dendrtic cells (pDC) but not on myeloid dendritic cells or other peripheral blood leukocytes. In response to IL-3, IL-3 receptor complex signaling downregulates ILT7 expression by pDC. ILT7 associates with the FcεRIγ signal adapter protein to form a receptor complex that can signal through activation of an immunoreceptor-based tyrosine activation motif (ITAM)-mediated signaling pathway. Signaling through the ILT7-FcεRIγ receptor complex negatively regulates the innate immune functions of pDC. ILT7 crosslinking inhibits TLR responses by pDC such as the stimulated production of type I interferon and other cytokines. Bone marrow stromal cell antigen 2 (BST2) has been identified as a biological ligand for ILT7.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLILRA4; CD85g; ILT7; ILT-7; Immunoglobulin-like transcript 7
Entrez Gene ID23547
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAGGGAGAGTGTAAGGGCGCTAGAAGTATCGATTTGT
Sequence IDAHS0168
ImmunogenILT7–FcεRIγ-transfected 2B4 cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940252 Oligo Mouse Anti-Human ILT-7 (CD85g) 17G10.2 (also known | IRIGHT