Description
The 5D3/CD338 monoclonal antibody specifically binds to an epitope of ABCG2 (BCRP1), a multi-drug resistance protein that is a member of ATP binding cassette (ABC) transporters. It is highly expressed on primitive stem cells as identified by the "side-population" (SP) phenotype. This SP phenotype is based on the efflux of fluorescent dyes such as Rhodamine 123 and Hoechst 33342. The expression of ABCG2 appears to be highly conserved as it has been identified in various species. Studies show that highly purified murine stem cells express BCRP1 mRNA and this expression declines sharply as the stem cells express CD34. The highest levels of BCRP1 mRNA expression have been seen in KDR+ human stem cells. ABCG2/BCRP1 was clustered as CD338 in the HLDA8 workshop.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameABCG2; ABCP; BCRP; BMDP; MXR1; ABC15; BCRP1; CDw338; EST157481; MGC102821
Entrez Gene ID9429
Vol. Per Test2 µl
IsotypeMouse IgG2b, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAATTCGCTAGTTGGTTTCGGCCTTTGCATGATCGGG
Sequence IDAHS0172
ImmunogenHuman ABCG2-transfected Mouse cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse