Description
The ZM3.8 monoclonal antibody specifically binds to CD85k which is also known as Immunoglobulin-like transcript 3 (ILT-3) and Monocyte inhibitory receptor HM18. CD85k is encoded by LILRB4 (Leukocyte immunoglobulin-like receptor, subfamily B member 4) and is expressed as a type I transmembrane glycoprotein. CD85k is comprised of two C2-type Ig domains, a transmembrane region, and a cytoplasmic tail with three immunoreceptor tyrosine-based inhibitory motifs (ITIMs). CD85k is selectively expressed by myeloid antigen presenting cells including monocytes, macrophages, and dendritic cells. CD85k functions as an inhibitory receptor. ILT3 can also function in antigen capture and presentation. It is efficiently internalized upon cross-linking, and delivers its ligand to an intracellular compartment where it is processed and ultimately presented by APCs to T cells. Thus, ILT3 is a novel inhibitory receptor that can negatively regulate activation of APCs and can be used by APCs for antigen uptake. ILT3 expression is upregulated on tolerogenic dendritic cells that can induce regulatory T cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLILRB4; ILT-3; HM18; LIRB4; LIR-5
Entrez Gene ID11006
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAGTAGTCGTAGTTGGCGTGAATTGGGCTTATATCTG
Sequence IDAHS0179
ImmunogenHuman ILT3 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse