Description
The HTF-1 monoclonal antibody specifically binds to CD142. CD142 is a 45-47 kDa, single chain, type I transmembrane glycoprotein also known as Tissue Factor (TF). CD142 has been referred in the literature as coagulation Factor III or thromboplastin and it is expressed on activated endothelial cells and lipopolysaccharide (LPS)-stimulated monocytes/macrophages. TF associates with factor VIIa to form a complex and acts as an enzyme that initiates the blood coagulation cascade. It is known as the major initiator of clotting in normal hemostasis. CD142 can be induced by various inflammatory mediators in monocytes and vascular endothelial cells. This antibody is useful in inflammation, thrombosis and hemostasis research.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameTissue factor; TF; TFA; Coagulation factor III; F3; Thromboplastin
Entrez Gene ID2152
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGGGATAGGTAAACGACGACGGAAATGACGGAAACG
Sequence IDAHS0202
ImmunogenHuman Tissue Factor Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940280 Oligo Mouse Anti-Human CD142 HTF-1 | IRIGHT