Description
The J4-117 monoclonal antibody specifically recognizes CD72. CD72 is a 39-43 kDa type II integral membrane protein that belongs to the C-type lectin superfamily. CD72 is expressed on B cells from early precursor stages through mature B cells. CD72 is not expressed on plasma cells. CD72 is also expressed on follicular dendritic reticulum cells and some macrophages. CD72 has been reported to bind to CD5, a glycoprotein expressed on all mature T cells and a subpopulation of B cells, suggesting a role in regulating T- and B-cell activation and proliferation.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLyb-2; LYB2
Entrez Gene ID971
Vol. Per Test2 µl
IsotypeMouse IgG2b, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTAGAGTCGTTATCGTTGAGCGTATGAGCGTAGGCCT
Sequence IDAHS0215
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940293 Oligo Mouse Anti-Human CD72 J4-117 | IRIGHT