Description
The 8C11 monoclonal antibody recognizes the extracellular domain of human N-Cadherin (CD325). Cadherins are a family of Ca2+ -dependent intercellular adhesion molecules that play a central role in controlling morphogenetic movements during development. Their function is regulated by association with the actin cytoskeleton by a complex of cytoplasmic proteins called the catenins (α, β, γ). Members of the cadherin family include P-cadherin , E-cadherin (uvomorulin), N-cadherin (neural cadherin), R-cadherin, cadherin 5, L-CAM, and EP-cadherin. N-cadherin mRNA is found at elevated levels in brain and heart and at a much lower level in liver. Mechanisms such as mRNA expression, cytokine modulation, and protease-mediated turnover modulate N-cadherin protein levels during development. In addition, N-cadherin function is indirectly regulated by endogenous kinases and phosphatases. Tyrosine phosphorylation of β-catenin complexed with N-cadherin results in dissociation of N-cadherin from actin. However, N-cadherin also interacts with a PTP1B-like phosphatase that dephosphorylates β-catenin and promotes N-cadherin/actin association. Thus, N-cadherin is an integral adhesion molecule whose function is regulated by protein-protein interactions and phosphorylation/dephosphorylation events.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCadherin-2, N-Cadherin; NCAD; CDHM; CDH2
Entrez Gene ID1000
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTAGGATGAGTTTCGTAAGTAAGGTAGTCGTATGGCT
Sequence IDAHS0223
ImmunogenHuman extracellular N-Cadherin domain Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse