Description
The SKII.4 monoclonal antibody specifically binds to the Poliovirus Receptor (PVR) which is also known as CD155, or Nectin-like protein 5 (NECL5). PVR is a ~70 kDa nectin-like type I transmembrane glycoprotein that belongs to the PVR-related (PRR) family within the Ig superfamily. In addition to two cell surface PVR isoforms (alpha and delta), two secreted PVR isoforms (beta and gamma) have been reported that share the same three Ig domains but differ in their C-termini. PVR is expressed on monocytes, macrophages, endothelial cells, epithelia cells, CD34+ thymocytes, and neurons. In addition to serving as a receptor for poliovirus and cytomegalovirus, PVR functions as an adhesion molecule involved in cell-cell and cell-matrix adhesion through interaction with CD96 (TACTILE), Nectin 1-3 (CD111, CD112, CD113), CD226, and vitronectin. PVR promotes natural killer (NK) cell adhesion to and lysis of target cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative Namepoliovirus receptor; HVED; nectin-like protein 5; NECL5; Necl-5; PVR; PVS; TAGE4
Entrez Gene ID5817
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAATGGAGTCGTAAGGCGGTAAGCAGTAAGTGGCGTT
Sequence IDAHS0229
ImmunogenSK-N-AS neuroblastoma cell line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse