Description
The BU63 monoclonal antibody specifically recognizes CD86 which is also known as B70, B7-2, B7.2, LAB72 or CD28LG2. CD86 is a ~70-80 kDa type I transmembrane glycoprotein that belongs to the Ig gene superfamily. CD86 is expressed on monocytes, dendritic cells, Langerhans cells, activated B cells, and memory B cells. Like CD80 (B7-1), CD86 serves as a ligand for CD28 or CD152 (CTLA-4) expressed by T cells and can induce costimulatory or coinhibitory signals, respectively. The BU63 antibody can reportedly block the binding of other human CD86-specific antibodies including the 2331 (FUN-1) (complete block) or IT2.2 (partial block) antibodies. These results suggest that the BU63 antibody may bind to a similar or identical CD86 epitope as the 2331 (FUN-1) antibody but to a different, although spatially-related epitope compared with the IT2.2 antibody.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameB7.2; B7-2; B-lymphocyte activation antigen B7-2; B70; CD28LG2; LAB72
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAGTTTGGTAGAATGGTAAGACGGGAATAGCGATGGT
Sequence IDAHS0245
ImmunogenHuman ARH 77 Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940315 Oligo Mouse Anti-Human CD86 BU63 | IRIGHT