Description
The HMFG2 (Milk Fat Globule 2) monoclonal antibody, formerly known as clone 3.14.A3, specifically binds to Mucin-1 (MUC1) which is also known as CD227, Episialin, Breast carcinoma-associated antigen DF3, Cancer antigen 15-3, H23 antigen, Peanut reactive urinary protein (PUM), Polymorphic epithelial mucin (PEM), or Epithelial membrane antigen (EMA). MUC1 (CD227) is a heterodimeric cell surface glycoprotein that belongs to the epithelial mucin family. As a result of proteolytic cleavage, MUC1 (CD227) is comprised of a large, extracellular N-terminal alpha subunit that contains a domain of 20 amino-acid tandem repeats and functions in cellular adhesion. The smaller transmembrane C-terminal beta subunit contains a cytoplasmic domain that is involved in cell signaling. MUC1 (CD227) is variably expressed on the surfaces of normal and malignant glandular and ductal epithelial cells, myeloma cells, and some hematopoietic cell lineages including subsets of T cells, B cells, monocytes and dendritic cells. Soluble forms of MUC1 (CD227) may arise by shedding from the cell surface or by secretion of forms derived from alternative RNA splicing. MUC1 (CD227) plays roles in the provision of protective barrier function, the regulation of cellular adhesion and migration, and the transduction of multiple signal pathways. The HMFG2 antibody recognizes epitopes within the tandem repeat domain of MUC1 (CD227).
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameMUC-1; DF3; EMA; Episialin; H23 antigen; H23AG; KL-6; MAM6; PEM; PEMT; PUM
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, λ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAGTGCATGGTTAGTAGGTGTGAGTCGTTAGATATTC
Sequence IDAHS0247
ImmunogenHuman Milk fat globule followed by epithelial cells cultured from milk
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940317 Oligo Mouse Anti-Human MUC1 (CD227) HMFG2 (also known | IRIGHT