Description
The L17F12 monoclonal antibody specifically binds to CD5 which is also known as Lymphocyte antigen T1 (T1) or LEU1/Leu-1. CD5 is an ~67 kDa single-chain, type 1 transmembrane glycoprotein expressed on most thymocytes, the majority of peripheral T lymphocytes and a subpopulation of B cells. CD5+ B cells produce polyreactive antibodies (mostly IgM). This CD5-specific antibody also reacts with many T-cell leukemias and lymphomas and most Ig+ B-cell chronic lymphoblastic leukemia (B-CLL) cells. CD72 has been shown to be the natural ligand for CD5.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLEU1; Leu-1; Lymphocyte antigen T1; T1; LY1; Tp67
Entrez Gene ID921
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG2a, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGTGAAGTATATTGCGGATTAAAGCTCGGTAGGATGT
Sequence IDAHS0248
ImmunogenHuman T-cell acute lymphoblastic leukemia (T-ALL) cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse