Description
The 30-F11 clone has been reported to react with all isoforms and both alloantigens of CD45, which is found on hematopoietic stem cells and all cells of hematopoietic origin, except erythrocytes. CD45 is a transmembrane glycoprotein which is expressed at high levels on the cell surface, and its presence distinguishes leukocytes from non-hematopoietic cells. CD45 is a member of the Protein Tyrosine Phosphatase (PTP) family, where the intracellular carboxy-terminal region contains two PTP catalytic domains, and the extracellular region is highly variable due to alternative splicing of exons 4, 5, and 6 (designated as A, B, and C, respectively). CD45 isoforms play complex roles in T-cell and B-cell antigen receptor signal transduction and the CD45 isoforms detected in the mouse are cell type-, maturation-, and activation state-specific.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NamePtprc; LCA; Leukocyte common antigen; T200; Ly-5; Lyt-4
Entrez Gene ID19264
Vol. Per Test2 µl
IsotypeRat LOU, also known as Louvain, LOU/C, LOU/M IgG2b, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGCGATTGCTTAGTTACGTGGTTCATTAGGCGGGATT
Sequence IDAMM2004
ImmunogenMouse Thymus / Spleen
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat