Description
The 500A2 monoclonal antibody specifically binds to the 25-kDa ε chain of the T-cell receptor-associated CD3 complex expressed on mouse thymocytes, mature T lymphocytes, and NKT cells. Plate-bound and soluble forms of the 500A2 antibody can activate T cells in vitro. Activation of a mouse T-cell clone by the 500A2 antibody can be blocked by Fab fragments of the GK1.5 anti-CD4 antibody. This suggests that the 500A2 antibody may bind an epitope on CD3e close to a site at which CD4 associates with the T-cell receptor. The 500A2 antibody reportedly does not to crossreact with rat leukocytes.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
8. Please refer to bd.com/genomics-resources for technical protocols.
9. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD3; CD3 epsilon; Cd3e; CD3ε; T3e
Entrez Gene ID12501
Vol. Per Test2 µl
IsotypeSyrian Hamster IgG2, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTGCGGTCAGGTAGGGTGTTGTAATTAATCGTATCTT
Sequence IDAMM2111
ImmunogenMouse T-cell receptor
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesSyrian Hamster