Description
The 2.11 monoclonal antibody recognizes the Vγ1.1 chain of the heterodimeric γδ T-cell receptor (TCR γδ) expressed by T lymphocytes and NK-T cells. It does not react with TCR αβ-bearing T cells. TCR γδ associates with CD3 molecules to form the TCR γδ/CD3 complex that mediates antigen recognition and can transduce intracellular signals leading to T cell responses. The Vγ1.1 TCR is also known as Vγ1 TCR. The Vγ1.1 variable region TCR gene segment primarily rearranges to join the Jγ4 and Cγ4 TCR gene segments. TCR Vγ1-expressing cells represent a major population of TCR γδ cells in the adult mouse thymus, peripheral lymphoid tissues, and different epithelia. They constitute a minor population of TCR γδ-positive T cells during fetal and early postnatal life.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
8. Please refer to bd.com/genomics-resources for technical protocols.
9. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameTCR V gamma 1.1; TCR Vg1.1; TCR V-gamma-1; TCR Vg1; Cr4
Entrez Gene ID107692
Vol. Per Test2 µl
IsotypeArmenian Hamster IgG
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTTAGTATGAGCCTGAATTGCGATGACGTTGCGGGTT
Sequence IDAMM2118
ImmunogenMouse TCR γδ+ T3.13.1 hybridoma cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesArmenian Hamster