Description
The 10B4 monoclonal antibody specifically binds to mouse Clec9A. Mouse Clec9A (C-type lectin domain family member 9A) is also known as DNGR1 (Dendritic cell natural killer lectin group receptor 1). It is a type II membrane protein with a single extracellular C-type lectin domain. Clec9A is a dendritic cell subtype-restricted C-type lectin-like receptor. Clec9A is selectively expressed on plasmacytoid dendritic cells and CD8+ myeloid dendritic cells. Clec9A reportedly serves as a receptor for necrotic cells. It can mediate the cross-presentation of dead-cell associated antigens in a Syk-dependent manner.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameCD370; CLC9A; Clec9a; DNGR-1; C-type lectin domain family 9 member A
Entrez Gene ID232414
Vol. Per Test2 µl
IsotypeRat WI, also known as Wistar (outbred) IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceATTGTATTACGTTGAAGTGTGGTCGGCGCAGTGTTT
Sequence IDAMM2128
ImmunogenMouse Clec9A Peptide
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat