Description
The MECA-32 antibody reacts with a dimer of 50-55–kDa subunits expressed on most or all endothelial cells in the embryonic and adult mouse, with the exception of cardiac and skeletal muscle and the brain. Normally in skeletal and cardiac muscle, MECA-32 antigen expression is limited to small arterioles and venules; however, under conditions of inflammation, it can be induced on previously non-expressing vessels in cardiac muscle. In the central nervous system (CNS), the panendothelial cell antigen expression is developmentally regulated. During embryonic development, the antigen is found on brain vasculature up to day 16 of gestation, after which it disappears. The cessation of MECA-32 antigen expression in the CNS may be associated with the establishment of the blood-brain barrier, which begins on day 16 of gestation. In the adult mouse, inflammation in the CNS can lead to re-expression of the panendothelial cell antigen.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NamePlvap; Pv1; MECA32; Plasmalemma vesicle-associated protein
Entrez Gene ID84094
Vol. Per Test2 µl
IsotypeRat IgG2a, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGTTTGTATTCGGGTTGTGAGTTGCTGCGGTAAGTTG
Sequence IDAMM2149
ImmunogenMouse lymph node stromal cells
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat
BD 940348 Oligo Rat Anti-Mouse Panendothelial Cell Antigen MECA-32 | IRIGHT