Description
The 1B3.3 antibody reacts with the Vβ 8.3 T-cell Receptor (TCR), but not the Vβ 8.1 nor Vβ 8.2 TCR, of mice having the b haplotype (e.g., A, AKR, BALB/c, CBA/Ca, CBA/J, C3H/He, C57BL, C58, DBA/1, DBA/2) of the Tcrb gene complex. The Tcrb-V8 subfamily gene loci are deleted in mice having the a (e.g., C57BR, C57L, SJL, SWR) or c (e.g., RIII) haplotype. Vβ 8.3 is one of the restricted TCR β chains expressed by NK-T cells. Staphylococcal enterotoxin B, in association with antigen-presenting cells expressing I-A and/or I-E, stimulates lymphocytes bearing Vβ 8 TCR and selectively eliminates those T cells in vivo. Vβ 8.3 TCR-bearing T-cell clones can be activated by 1B3.3 mAb. This hamster mAb to a mouse leukocyte antigen does not cross-react with rat leukocytes.
Put all BD AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. This product is covered by one or more of the following patents: US 8,835,358; US 9,290,808; US 9,290,809; US 9,315,857; US 9,567,645; US 9,567,646; US 9,598,736; US 9,708,659; and US 9,816,137. This product, and only in the amount purchased by buyer, may be used solely for buyer’s own internal research, in a manner consistent with the accompanying product literature. No other right to use, sell or otherwise transfer (a) this product, or (b) its components is hereby granted expressly, by implication or by estoppel. Diagnostic uses require a separate license.
7. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
8. Although hamster immunoglobulin isotypes have not been well defined, BD Biosciences Pharmingen has grouped Armenian and Syrian hamster IgG monoclonal antibodies according to their reactivity with a panel of mouse anti-hamster IgG mAbs. A table of the hamster IgG groups, Reactivity of Mouse Anti-Hamster Ig mAbs, may be viewed at http://www.bdbiosciences.com/documents/hamster_chart_11x17.pdf.
9. Please refer to bd.com/genomics-resources for technical protocols.
Specifications

General

BrandBD™ AbSeq
Alternative NameTCR V beta 8.3; TCR Vβ8.3
Vol. Per Test2 µl
IsotypeArmenian Hamster IgG3, λ1
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceGGAGAGGATTGCGTTGGGTGTATTAAGATGCGATTG
Sequence IDAMM2157
ImmunogenVβ 8.3 TCR-expressing mouse Th1 clone 3.L2
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesArmenian Hamster
BD 940353 Oligo Hamster Anti-Mouse Vβ 8.3 T-Cell Receptor 1B3.3 | IRIGHT