Description
The H35-17.2 monoclonal antibody specifically binds to both alloantigeneic forms of the β chain of the CD8 differentiation antigen (Ly-3 or Lyt- 3). The CD8 α and α' chains (CD8a) form heterodimers with the CD8 β chain (CD8b, Ly-3, or Lyt-3) on the surface of most thymocytes. A subpopulation of mature T lymphocytes (i.e., MHC class I-restricted T cells, including most T suppressor/cytotoxic cells) expresses almost exclusively the CD8 αβ heterodimer (the α' chain is absent). Subsets of γδ TCR-bearing T cells, intestinal intraepithelial lymphocytes, and dendritic cells express CD8a without CD8b. It has been suggested that the expression of the CD8a/CD8b heterodimer is restricted to T lymphocytes which matured in the thymus or in an extrathymic environment that had been influenced by thymus- initiated neuroendocrine signals. CD8 is an antigen coreceptor on the T-cell surface which interacts with MHC class I molecules on antigen-presenting cells. It participates in T-cell activation through its association with the T-cell receptor complex and protein tyrosine kinase lck (p56lck). The H35-17.2 mAb blocks T-cell-mediated cytolysis of allogeneic lymphoma cells.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameLy-3; Lyt-3; Lymphocyte antigen 3; Ly-C; CD8b1
Entrez Gene ID12526
Vol. Per Test2 µl
IsotypeRat IgG2b, κ
ReactivityMouse (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTTTCGGGCGGTTATAGTATTAGTTGAGTCCAGCATC
Sequence IDAMM2189
Immunogen5-day MLR, C57BL/6 anti-BALB/c
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesRat