Description
The 515 monoclonal antibody specifically binds to CD44. CD44 is an 80-95 kDa type I transmembrane glycoprotein, also known as Phagocytic glycoprotein-1 (Pgp-1), or Extracellular matrix receptor type III (ECMR-III). CD44 is a member of the hyaladherin family of hyaluronan-binding proteins, with structural similarities to selectins. CD44 is the receptor for hyaluronic acid. CD44 is expressed on leucocytes, erythrocytes, epithelial cells and weakly on platelets. CD44 has functional roles in cell migration, lymphocyte homing and adhesion during hematopoiesis and lymphocyte activation. The 515 monoclonal antibody can reportedly block cellular adhesion to hyaluronic acid.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NamePgp-1; CSPG8; ECMR-III; Epican; H-CAM; HCELL; Hermes; HUTCH-1
Entrez Gene ID960
Vol. Per Test2 µl
IsotypeMouse BALB/c IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAGTATTGTGAGCGAGCGTTGGCGTAGTTAGAGGATG
Sequence IDAHS0140
ImmunogenHuman EBV-transformed Arent B Lymphoblastoid Cell Line
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse
BD 940364 Oligo Mouse Anti-Human CD44 515 | IRIGHT