Description
The 51-10C9 monoclonal antibody specifically binds to CD106. CD106 is a 100-110 kDa type I transmembrane sialoglycoprotrein that is also known as Vascular cell adhesion molecule-1 (VCAM-1) and INCAM-110. CD106 is expressed at high levels on the surface of cytokine-stimulated endothelium, and at minimal levels on unstimulated endothelium. VCAM-1 serves as a ligand for the leukocyte integrins α4β1 (CD49d/CD29 complex; VLA-4) and α4β7 (LPAM-1). The 51-10C9 monoclonal antibody inhibits the in vitro binding of lymphocytes and monocytes to VCAM-1 on stimulated endothelium.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameVCAM-1; Vascular cell adhesion protein 1; INCAM-100; L1CAM
Entrez Gene ID7412
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceTCTGATTTAGCGGGTGGACGTATTATAGTGATTGGC
Sequence IDAHS0251
ImmunogenHuman VCAM-1 Recombinant Protein
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse