Description
The 68-5H11 monoclonal antibody specifically binds to CD62E. This adhesion molecule is a 97-115 kDa type I transmembrane glycoprotein that is encoded by the SELE gene. CD62E is also known as E-selectin, Endothelial-leukocyte adhesion molecule-1 (ELAM-1), and Leukocyte endothelial cell adhesion molecule 2 (LECAM-2). CD62E is minimally expressed by unstimulated endothelium. Activated endothelial cells upregulate surface CD62E expression in response to various activators including inflammatory cytokines such as Interleukin-1 and Tumor Necrosis Factor. CD62E plays a role in leucocyte extravasation by promoting leucocyte rolling on activated endothelial cells during inflammation. CD62E may also play a role in the metastasis of certain tumor cells. The adhesion between endothelial CD62E molecules and a carbohydrate ligand on neutrophils is inhibited by the mAb 68-5H11.
Put all BD® AbSeq Reagents to be pooled into a Latch Rack for 500 µL Tubes (Thermo Fisher Scientific Cat. No. 4900). Arrange the tubes so that they can be easily uncapped and re-capped with an 8-Channel Screw Cap Tube Capper (Thermo Fisher Scientific Cat. No. 4105MAT) and the reagents aliquoted with a multi-channel pipette. BD® AbSeq tubes should be centrifuged for ≥ 30 seconds at 400 × g to ensure removal of any content in the cap/tube threads prior to the first opening.
Store undiluted at 4°C and protected from prolonged exposure to light. Do not freeze. The monoclonal antibody was purified from tissue culture supernatant or ascites by affinity chromatography and conjugated to BD® AbSeq oligonucleotide under optimal conditions.
1. This reagent has been pre-diluted for use at the recommended volume per test. Typical use is 2 µl for 1 × 10^6 cells in a 200-µl staining reaction.
2. Source of all serum proteins is from USDA inspected abattoirs located in the United States.
3. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing.
4. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots.
5. Illumina is a trademark of Illumina, Inc.
6. Please refer to http://regdocs.bd.com to access safety data sheets (SDS).
7. Please refer to bd.com/genomics-resources for technical protocols.
8. For U.S. patents that may apply, see bd.com/patents.
Specifications

General

BrandBD™ AbSeq
Alternative NameSELE; E-selectin; Selectin E; ELAM; ELAM1; ESEL; LECAM2
Entrez Gene ID6401
Vol. Per Test2 µl
IsotypeMouse IgG1, κ
ReactivityHuman (Tested in Development)
ApplicationSingle Cell 3' Sequencing (Qualified)
Barcode SequenceAGAGAGGAGTAGGTCGACAGTTTAAGGCGCAGAAGT
Sequence IDAHS0254
Storage BufferAqueous buffered solution containing BSA and ≤0.09% sodium azide.
Regulatory StatusRUO
Host SpeciesMouse